
DNA starts with: TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT [*|] ToDo: PagePath: # KurtMehlhorn JuergNievergelt BernhardPlattner RalphKeller UrsHoelzle StefanSavage # [] # [] # [] # [] # [] # [] # [] # [] # [] # CraigVenter []