b- CraigVenter edit** - wiki at8a.....

DNA starts with: TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT [*|http://huref.jcvi.org/fetchData.pl?mode=alignment&format=export&search=1103411000000:0-10000:1] ToDo: PagePath: # KurtMehlhorn JuergNievergelt BernhardPlattner RalphKeller UrsHoelzle StefanSavage # [http://dblp.uni-trier.de/db/indices/a-tree/a/Anderson:Thomas_E=.html] # [http://dblp.uni-trier.de/db/indices/a-tree/b/Bershad:Brian_N=.html] # [http://dblp.uni-trier.de/db/indices/a-tree/l/Levy:Henry_M=.html] # [http://dblp.uni-trier.de/db/indices/a-tree/c/Chase:Jeffrey_S=.html] # [http://dblp.uni-trier.de/db/indices/a-tree/b/Becker:David.html] # [http://dblp.uni-trier.de/db/indices/a-tree/s/Singh:Raj_K=.html] # [http://dblp.uni-trier.de/db/indices/a-tree/w/White:C=_Thomas.html] # [http://dblp.uni-trier.de/db/indices/a-tree/h/Hardies:S=_C=.html] # [http://dblp.uni-trier.de/db/indices/a-tree/h/Hutchison_III:C=_A=.html] # CraigVenter [http://dblp.uni-trier.de/db/indices/a-tree/v/Venter:J=_C=.html]